                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:158 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-15.50 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -4.40 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G= -8.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGTCTAAGAGTTACCCCGAAACTCCCCATGAAATCGCTTCATCTCCTTATCGCCAAGA
GGTTTTGCAGGAAATCTTAACGCATTTCCAATCAAATCTTTAAtagtttgttttcgtagagaggctgg
gttcagcctctcttttctcttccattagccacactaggttttatatcctcgagattccttttaaaaagcttctcgagtatacttctccactaggcacaaa
cgtagtttctatccctccttcaaggtagaagttttctctgagagaaaagtacatttttgcttgtgaggataacaATG

    mhpA Gene: mhpA     GI: 15604867     BI number: CT148     GOG: COG0654     Description: Monooxygenas             t           t  g AA       t  t T  C       gt T  G       at C  C      |  t TA       t  c AT       A  g AT        At AT        Ta GC        Tg GC        Ta A  A       Cg C  A       Ta        gt G  T      A  |      g  t T  C      A  |       gc TA       A  |       ta TA        Cg        cg TA        Tg        gc GT       A  c       gc GC        At        at AT        Cg        gc GT        Cg        at AT        Tg        gc                         ttttctcttccattagccacactaggttttatatcctcgagattccttttaaaaagcttctcgagtatacttctccactaggcacaaacgtagtttctatccctccttcaaggtagaagttttctctgagagaaaagtacatttttgcttgtgaggataacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [HC] COG0654 2-polyprenyl-6-methoxyphenol hydroxylase and related FAD-dependent oxidoreductases ... can be seen here     ..................................................................................................................