                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:33 nt.     Distance to run of Ts=2 nt.   Size=20 nt.     Delta G= -6.20 kcal/mol
Antiterminator: Size=50 nt.     Delta G=-16.70 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G= -6.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gttgttaatgaacaaatattctgttttagcagttttggtacataagtatagctgcagcatgccatgcaaatcagcttttcaagctgattgcttccaagat
attcaaaaattcatcctcttacagcgtgcctggctttcttttgaaagctggcgcttatctacttggcgataggcctaattaagaagccttttatttgatt
aagagatgttcttatagaagtaagagcgtcttttttgcgcaggattattctgtcgccagttttttctatgattttaacactataattttatggagaaaag
ATG

    trpB --- trpA Gene: trpB     GI: 15604889     BI number: CT170     GOG: COG0133     Description: Tryptophan Synthase (Beta Chain) Gene: trpA     GI: 15604890     BI number: CT171     GOG: COG0159     Description: Tryptophan Synthase (Alpha Chain            ga           a  a            tg            at            ta            ta            cg            ta tg        tg t  a       gc t  t       tg at        at ta        gc ta        at tg        gt ta        at         t cg        at       t  a |  a      |  t       at c  t      |  t       gt g  g      t  g       gc at       t  c       at at       a  g       cg gc        gc       |  t at        ta        gc at        tg        cg ta        tg        gc                         cagttttttctatgattttaacactataattttatggagaaaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0133 Tryptophan synthase beta chain ... can be seen here [E] COG0159 Tryptophan synthase alpha chain ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_trachomatis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:65 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-12.90 kcal/mol Antiterminator: Size=43 nt.     Delta G= -6.10 kcal/mol Anti-antiterminator:   Size=49 nt.     Delta G=-10.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case gttgttaatgaacaaatattctgttttagcagttttggtacataagtatagctgcagcatgccatgcaaatcagcttttcaagctgattgcttccaagat attcaaaaattcatcctcttacagcgtgcctggctttcttttgaaagctggcgcttatctacttggcgataggcctaattaagaagccttttatttgatt aagagatgttcttatagaagtaagagcgtcttttttgcgcaggattattctgtcgccagttttttctatgattttaacactataattttatggagaaaag ATG     trpB --- trpA Gene: trpB     GI: 15604889     BI number: CT170     GOG: COG0133     Description: Tryptophan Synthase (Beta Chain) Gene: trpA     GI: 15604890     BI number: CT171     GOG: COG0159     Description: Tryptophan Synthase (Alpha Chain tt c  g a  g t  c       tg cg       t  a ta       t  t at        at ta        ta tg        ta cg        tg gc        ta c  |       cg gc       |  a       ga gt       c  t      a  a ta       g  g       tg c  a       at        at g  |       at        ta at        gc        ta at        at        cg a  a       at        ta g  |       ta        tg ta       t  |       gc tg       a  |       tg ta        at        at ta        ta        gc cg        cg        at                         tttttgcgcaggattattctgtcgccagttttttctatgattttaacactataattttatggagaaaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0133 Tryptophan synthase beta chain ... can be seen here [E] COG0159 Tryptophan synthase alpha chain ... can be seen here     ..................................................................................................................