Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:87 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-12.90 kcal/mol
Antiterminator: Size=77 nt.     Delta G=-14.99 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G= -7.89 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGTGCTTCGTTAACTGCTACTACTCTAGGAGTTCTTTCTCCTTTCTTCTTTGCAAAAA
TCGGCGTTGATCCGGCTTTAGCTTCTGGTCCGATTGTTACAGCTCTTAACGATATCAT
GTCGATGGTCATCTTCCTATTGATCACCGGTACTCTAAATGTTTTATTTTTCAAATAG
tgggtgagtccgaagacaaaggttttcttcgggcttttttcactatgtcttttctccctctctctttagaatgattcatgaattttattatttttttaga
attcgcttagataaaggagtggatttGTG

    tgt --- CT192


Gene: tgt     GI: 15604913     BI number: CT193     GOG: COG0343     Description: Queuine tRNA Ribosyl Transferase
Gene: CT192     GI: 15604912     BI number: CT192     GOG: NOG12084     Description: hypothetical protei


            g
          a  t
          g  c
          t  c
           gg
           ga
          g  a
          t  g
          G  a
          A  c
          T  a
  A       A  a
T  A      A  a
C  A      A
T  T       C
 CG        T
 AT       |
T  T       T
G  T       T
G  T       T
C  A       T
C  T       A
A  T      T
C  T      T  |
T  T       T
 AT        T
 GC        G         g
|  A       T       a  g
 TA        A       a  t
 TA        A       a  t
 AT       |        c  t
 TA       |         at
 CG        A        gc
C  t       T        at
T  |       C        at
 Tg       T         gc
 Cg       C         cg
 Tg        A        cg
 At        T        tg
 Cg        G        gc
 Ta        G        at
                        tttttcactatgtcttttctccctctctctttagaatgattcatgaattttattatttttttagaattcgcttagataaaggagtggatttGTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG0343 Queuine/archaeosine tRNA-ribosyltransferase ... can be seen here

    ..................................................................................................................