                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:62 nt.     Distance to run of Ts=3 nt.   Size=21 nt.     Delta G= -6.40 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G= -6.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGAGCTACTATAGGAGGAGTGATATTAACGGCTCGACATGCTCTAACAGGGGAATTAA
CTCCTCCTGGAAAATATTGACAGGCTTTAGAGAAGAGGTGGGACATaagcagagatctctgtaaag
attggggaaagggaagtgtataccaggatcgcattaaaaaaaagatgatggattcgcagactggagaggacttgatttcgatctcagacatagtgtatgt
ttgacgcttatttctctctaagtgcaaggcggttgtaaggagagaaaaccttaaaaataacaacaggttaggtgctATG

    leuS --- gseA Gene: leuS     GI: 15604929     BI number: CT209     GOG: COG0495     Description: Leucyl tRNA Synthetase Gene: gseA     GI: 15604928     BI number: CT208     GOG: COG1519     Description: KDO Transferas   a a  a a  a a  g a  a at tg ta at cg g  | cg        tg ta       t  a at       c  t gt        at |  c       gt |  g       gc |  c      a  g |  a      g  a |  g       at |  a       gc gc       |  t at        gc         t cg        ta       g  g cg        cg        at a  a      |  a       ta t  g      |  c       at a  a      a  a       cg t  g      g  t       at g  g      a  a       gt ta        cg        at gc        gt        cg at        cg        ta                         cgcttatttctctctaagtgcaaggcggttgtaaggagagaaaaccttaaaaataacaacaggttaggtgctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0495 Leucyl-tRNA synthetase ... can be seen here [M] COG1519 3-deoxy-D-manno-octulosonic-acid transferase ... can be seen here     ..................................................................................................................