                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:37 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-11.20 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -3.34 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aactattttctctttttaatttttattctgcacacattgaacaccaaggttattttaatataactgatctttagaacggggaaaaatcgcagagtctttc
attttctttacctcaccttctcaaagatcttaactaaagactccaggaaagatcgtttatcttgaggttttctcctacgaaataaatgtttgcatgctaa
gaaagatttatagacaatctgccatgtcgcatccgctctgacggagagtgtgttgcgcttttttgggttttcaccatatttaaaataggagcatcttcga
ATG

    dhnA --- xasA Gene: dhnA     GI: 15604935     BI number: CT215     GOG: COG1830     Description: Predicted 1,6-Fructose biphosphate aldolase (dehydrin family) Gene: xasA     GI: 15604936     BI number: CT216     GOG: COG0531     Description: Amino Acid Transporte   a t  g a  a t  c ta ta         c at       a  g gc       g  g at        ta |  g       cg |  c       ta a  c       cg a  a       gt g  t       cg a  g      |  t a  t      c  g t  c      t  t cg        at gc        cg ta        gc at        cg             cttttttgggttttcaccatatttaaaataggagcatcttcgaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1830 DhnA-type fructose-1,6-bisphosphate aldolase and related enzymes ... can be seen here [E] COG0531 Amino acid transporters ... can be seen here     ..................................................................................................................