Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:37 nt.    Distance to gene:110 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -9.00 kcal/mol
Antiterminator:    Distance from promoter:17 nt. Size=31 nt.     Delta G= -3.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGTAT-TATTCT. It has a score value of 68.94 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTATTCCTTTTGGAATGTACTATTCTCACAAGAAATTAATTAAATAAattcttttgcacaga
aaagggctttgtaaagaagctcttttctttctaagacttacctggatttctaattcgcaaatctttaaaatttccctcatgtttacactacaatgtagtc
ctccatggacaaaattagggaaacgtgttgaaagtttaGTG

    ydaO


Gene: ydaO     GI: 15604937     BI number: CT217     GOG: COG0037     Description: PP-Loop Superfamily ATPas


  c
a  a
c  g
g  a
 ta         a
 ta       t  a
 ta       g  a
 tg        tg
 cg        ta
t  g       ta
t  c       cg
 at        gc
 At        gt
 At        gc
 Tg        at
 At        at
            ttctttctaagacttacctggatttctaattcgcaaatctttaaaatttccctcatgtttacactacaatgtagtcctccatggacaaaattagggaaacgtgttgaaagtttaGTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[D] COG0037 Predicted ATPase of the PP-loop superfamily implicated in cell cycle control ... can be seen here

    ..................................................................................................................