                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:99 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-17.30 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -9.80 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAATCTGAGAAGCTTTTGTTCAACTATAAGGCTCATCGCGACGTTTGTCTCGGAGAAA
AGGTTCTGGTGAAATCGGTTAATCTCATAGACCTGGATCCGAAATCGGATAGCAGTGA
TGGCGATGATGATGATGGTTTCAATTACGGCTCTCGGGTGTAGtttgccgagcaaaagcctcttctta
tgaagaggcttttttttctctcttaatctttgggaacgtctaaatgtttccgaagtagcaaattgttggtaatctgtgattaatgaattcactgcgtaca
gaaattgaggagcgatATG

    CT222 --- CT221.1 Gene: CT222     GI: 15604943     BI number: CT222     GOG: -------     Description: CHLTR hypothetical protein Gene: CT221.1     GI: 15604942     BI number: CT221.1     GOG: -------     Description: hypothetical protein-possible frameshift with CT22 TG A  G G  T       AG T  T      T  t AT       G  t GC       T  t |  A      G  g       ta TA        Gc       t  t AT        Gc        cg GT        Cg        ta TA        Ta        ta A  C       Cg        cg G  G      |  c       ta CG       |  a       cg GC       |  a       cg GT       |  a       gc T  C       Ta        at AT        Cg        at GC        Gc        at TG        Gc        at                         ttttctctcttaatctttgggaacgtctaaatgtttccgaagtagcaaattgttggtaatctgtgattaatgaattcactgcgtacagaaattgaggagcgatATG     ..................................................................................................................