                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:16 nt.     Distance to run of Ts=3 nt.   Size=22 nt.     Delta G= -7.40 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -3.30 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G= -7.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTTGTATAGGAGCTTTTGGATTAGTTTCTTACCTGTTATCTGTGATACGCAATTCAG
ATCAGCTATTACAAGAAGCCAAGGAAAGTGCGCGGAAAATTTCCAGCCATTATAGGGT
TTTAGAGACTCAGAAAAATAGGGAAATAGGCCTTTTAGAAGAGCGTGTGAATATGTTG
GATGGTTTTTATGCTAAATTTCATGGGTGGGATTAAggaaagcaagactttttagatctataaaagagttgac
gatacgcttttctatttagaggaaagcttctcttttaccttaagggggatgccATG

    CT224 Gene: CT224     GI: 15604945     BI number: CT224     GOG: -------     Description: hypothetical protei GG T  G AT CG T  G T  G TA AT AT |  A        c |  A      t  t |  g      a  a |  g      g  t |  a      a  a A  a       ta Ta        ta Cg        ta Gc        tg Ta        ta A  |       cg T  |       at T  |       gt Ta       |  g       tt Tg       |  a      t  a Ta       |  c      a  g Gc       |  g       ta Gt       |  a       cg T  t      |  t       tg At       a  a       ta Gt       a  c       ta Gt        cg        ta Ta        gc        cg Tg        at        gc                         ttctcttttaccttaagggggatgccATG     ..................................................................................................................