Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:21 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-11.30 kcal/mol
Antiterminator: Size=14 nt.     Delta G= -6.20 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G= -5.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTTTTACTCCCTTTAGAAGGAGTCTTACTGTTAGCGTGGTATTTCTATGAAGGAGCA
ATGCTTCCTCAAGCATATTGGTGGAATCCTTTTGTTTCCTATAACATTTCAAGTTTAC
TCATGCAGTGGGGATTAGGCGGAGGGGTTCTCTTTCTTCTTAACCGCAAGCTATACAC
AAAATTTTACTTAAACAACTAGattttaactgagttgcttgtaagtcttttgcatgatatactccttggccgatcggggccttc
taattcattgaaggctctttattgtgattcacagagggaaatATG

    incB


Gene: incB     GI: 15604953     BI number: CT232     GOG: NOG09582     Description: Inclusion Membrane Protein


 tg
t  c
t  a
t  t
 cg
 ta
 gt
a  a
 at
 ta
 gc
|  t                  t
|  c                t  c
|  c                a  a
|  t                a  t
t  t                t  t
 tg                  cg
 cg        tc        ta
 gc       a  g       ta
t  c      g  g       cg
t  g       cg        cg
g  a       cg        gc
 at        gc        gt
 gc        gc        gc
                        tttattgtgattcacagagggaaatATG
    ..................................................................................................................