                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:109 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -7.20 kcal/mol
Antiterminator: Size=50 nt.     Delta G= -7.60 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G= -9.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cggtttatgcttctcgccctaagcccttctgagtttttgatttagaaggcatttcgttggctgtatatacagtcgagatatagtagctgtgcaggatgct
cagtatgctaaaacccttacgcatagaatgtgcgaaagagtagacttgtagggattggttactctagttttatttaaagctagattttttttgctataga
ctctgcgagaaacccaatggcccattttaaatggccataagtcgaccgtctgcttaagatggaaggcgcttcattttgaaatgaaagtaaggatcatagg
ATG

    acpP Gene: acpP     GI: 15604957     BI number: CT236     GOG: COG0236     Description: Acyl Carrier Protei   a g  a a  t tg at        gg cg       a  g gc        ta cg        gt a  a      t  t ta        tg ta        cg cg        at c  |       gt c  |      a  | a  |       ta a  |       gc a  |       at a  |       gc ta        at cg       a  a gt       a  |       tt ta       g  |      a  t a  g       cg        ta ta        gt        ta gc       |  t       ta at       t  t       tg c  t       gt        gc t  |       ta        at cg        at        ta gt        at        cg ta        gt        ta                         ttttttttgctatagactctgcgagaaacccaatggcccattttaaatggccataagtcgaccgtctgcttaagatggaaggcgcttcattttgaaatgaaagtaaggatcataggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IQ] COG0236 Acyl carrier protein ... can be seen here     ..................................................................................................................