                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:116 nt.    Distance to gene:65 nt.     Distance to run of Ts=3 nt.   Size=23 nt.     Delta G= -7.00 kcal/mol
Antiterminator:    Distance from promoter:104 nt. Size=19 nt.     Delta G= -5.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgatg-tatttt. It has a score value of 75.64 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgatgtagagaggggggatggttattttccaagtgcatggaaaagataccctctataaaatgacgccaagttacatagtatgaagctccgttcggaaga
gcagagttgaatctcttgtaagcaaaagacgattctcgacaagaagtggagaggttttgtctttctgcaaagtttttttgattagggaattaaagcaacc
ttgataggaacgaggcttccctccccatagggagaacccacctcggATG

    CT251 Gene: CT251     GI: 15604972     BI number: CT251     GOG: COG0706     Description: 60kDa Inner Membrane Protei             t           t  t   g       t  g a  a       gt a  a       gc cg        at at        gt g  g       at cg        gc ta        gt cg        tg ta        gc             aaagtttttttgattagggaattaaagcaaccttgataggaacgaggcttccctccccatagggagaacccacctcggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG0706 Preprotein translocase subunit YidC ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_trachomatis                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:103 nt.    Distance to gene:87 nt.     Distance to run of Ts=1 nt.   Size=21 nt.     Delta G= -6.10 kcal/mol Antiterminator:    Distance from promoter:73 nt. Size=34 nt.     Delta G= -7.80 kcal/mol Anti-antiterminator:    Distance from promoter:42 nt.    Size=50 nt.     Delta G=-16.60 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgatg-tatttt. It has a score value of 75.64 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgatgtagagaggggggatggttattttccaagtgcatggaaaagataccctctataaaatgacgccaagttacatagtatgaagctccgttcggaaga gcagagttgaatctcttgtaagcaaaagacgattctcgacaagaagtggagaggttttgtctttctgcaaagtttttttgattagggaattaaagcaacc ttgataggaacgaggcttccctccccatagggagaacccacctcggATG     CT251 Gene: CT251     GI: 15604972     BI number: CT251     GOG: COG0706     Description: 60kDa Inner Membrane Protei ga g  a cg ta tg gc c  a cg ta        aa cg       t  g gt        gc at        ta a  g       ta g  a      c  a ta        ta at        cg         g t  |       ta       a  a gc       a  |      a  a at       a  |       cg |  c       gc        at t  t       tg       g  g at        ta        cg cg        gt        ta at        at        cg ta        gc        ta ta        at        tg                         gttttgtctttctgcaaagtttttttgattagggaattaaagcaaccttgataggaacgaggcttccctccccatagggagaacccacctcggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG0706 Preprotein translocase subunit YidC ... can be seen here     ..................................................................................................................