                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:9 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G= -8.10 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-10.31 kcal/mol
Anti-antiterminator:   Size=21 nt.     Delta G= -3.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCTCAGGTAGTATTTGAAAAAGATTTGCGACTTTCTAAATCAGTGACTCATGATGAC
ATTATAAACTGGTATTTTGATCCTGTACATTATTGTTTAGGGTACTTAGAACAGAGAT
ACATGCCATCTTAActcttctaatagggagggaggatctgtacagatcctcccttcggtctttgtccatgaaaacttgataataatctta
cgcaacaagtaccatgagatattctagagggatctctttctctcttcgtaaaggaattctgtagaagtagttttccttttttttcttaaaaggaTTG

    CT283 --- gcsH Gene: CT283     GI: 15605004     BI number: CT283     GOG: NOG04990     Description: hypothetical protein Gene: gcsH     GI: 15605003     BI number: CT282     GOG: COG0509     Description: Glycine Cleavage System H Protei            tc           c  t           t  t            at            gc            gt            gc            at            gc            at           |  t           |  c       ga           |  g      a  a           |  t      t  g           |  a       gt ag       |  a       ta t  a      |  a       cg cg        tg       t  t tg        cg       t  t tg        ta        at a  |       ta        at ta        at        gc at       t  |       gc gc        at        at at        gc        at gc        at        at                         tttttcttaaaaggaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0509 Glycine cleavage system H protein (lipoate-binding) ... can be seen here     ..................................................................................................................