                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:72 nt.    Distance to gene:7 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-13.60 kcal/mol
Antiterminator:    Distance from promoter:65 nt. Size=12 nt.     Delta G= -5.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaat-aagaat. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaatagtgaggtgcactccggaagaatcttaaaaatcttggtccacttgtcttgttaaagacggtaaagaccttgaagtaaagttttcttaacccccc
ttggggaaccagtcagtaatatgctggccccatatttttggagatATG

    CT300 Gene: CT300     GI: 15605021     BI number: CT300     GOG: -------     Description: hypothetical protei            aa           t  t           g  a            at            cg           t  |            gc            at            cg            cg           a  | ct       a  | c  t       gc cg        gc cg        gc cg        gc cg        ta             tatttttggagatATG     ..................................................................................................................