                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:170 nt.    Distance to gene:24 nt.     Distance to run of Ts=1 nt.   Size=22 nt.     Delta G= -8.80 kcal/mol
Antiterminator:    Distance from promoter:132 nt. Size=45 nt.     Delta G= -5.06 kcal/mol
Anti-antiterminator:    Distance from promoter:117 nt.    Size=26 nt.     Delta G=-10.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TAGATA-TAGATT. It has a score value of 68.94 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAGATATGAGCTCAGAGGTTTTGCTAGATTTATTGACTAGATTTTTACAGAAAGATTT
TCGGGAAATGATCTTTCAGTCTTGCTAAaggatctttggcttaaggggctatgttggttaaatcgttattgggaaaatt
cgttgacgatggaagctccgcaaactcggagtttttttgtatgcgttgagaaaagaagaactatctctggagagctgtctagagagtttcttagttgaag
gtgtaagagcggattATG

    CT309 --- atpA --- atpB --- atpD --- atpI Gene: CT309     GI: 15605030     BI number: CT309     GOG: NOG05142     Description: hypothetical protein Gene: atpA     GI: 15605029     BI number: CT308     GOG: COG1155     Description: ATP Synthase Subunit A Gene: atpB     GI: 15605028     BI number: CT307     GOG: COG1156     Description: ATP Synthase Subunit B Gene: atpD     GI: 15605027     BI number: CT306     GOG: COG1394     Description: ATP Synthase Subunit D Gene: atpI     GI: 15605026     BI number: CT305     GOG: COG1269     Description: ATP Synthase Subunit             t           g  t           c  g           g  a           t  g           a  a           t  a           g  a            ta            tg            ta            ta aa        tg a  c       ta c  t       ta        gc gc        gc       a  t cg       |  t      g  g cg       |  a       at ta       |  t       gc cg       |  c       gt gt        at        ta at        gc        cg at        gt        ta gt        cg        cg gt        tg        ta                         gtttcttagttgaaggtgtaagagcggattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1155 Archaeal/vacuolar-type H+-ATPase subunit A ... can be seen here [C] COG1156 Archaeal/vacuolar-type H+-ATPase subunit B ... can be seen here [C] COG1394 Archaeal/vacuolar-type H+-ATPase subunit D ... can be seen here [C] COG1269 Archaeal/vacuolar-type H+-ATPase subunit I ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_trachomatis                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:119 nt.    Distance to gene:77 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -8.80 kcal/mol Antiterminator:    Distance from promoter:83 nt. Size=41 nt.     Delta G= -8.40 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TAGATA-TAGATT. It has a score value of 68.94 and is shown in blue Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TAGATATGAGCTCAGAGGTTTTGCTAGATTTATTGACTAGATTTTTACAGAAAGATTT TCGGGAAATGATCTTTCAGTCTTGCTAAaggatctttggcttaaggggctatgttggttaaatcgttattgggaaaatt cgttgacgatggaagctccgcaaactcggagtttttttgtatgcgttgagaaaagaagaactatctctggagagctgtctagagagtttcttagttgaag gtgtaagagcggattATG     CT309 --- atpA --- atpB --- atpD --- atpI Gene: CT309     GI: 15605030     BI number: CT309     GOG: NOG05142     Description: hypothetical protein Gene: atpA     GI: 15605029     BI number: CT308     GOG: COG1155     Description: ATP Synthase Subunit A Gene: atpB     GI: 15605028     BI number: CT307     GOG: COG1156     Description: ATP Synthase Subunit B Gene: atpD     GI: 15605027     BI number: CT306     GOG: COG1394     Description: ATP Synthase Subunit D Gene: atpI     GI: 15605026     BI number: CT305     GOG: COG1269     Description: ATP Synthase Subunit aa a  a gt gt gc tg t  t at tg ta gc        aa cg       a  c ta       c  t at        gc |  g       cg a  g       cg a  a       ta ta        cg tg        gt gc        at gt        at             ttttgtatgcgttgagaaaagaagaactatctctggagagctgtctagagagtttcttagttgaaggtgtaagagcggattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1155 Archaeal/vacuolar-type H+-ATPase subunit A ... can be seen here [C] COG1156 Archaeal/vacuolar-type H+-ATPase subunit B ... can be seen here [C] COG1394 Archaeal/vacuolar-type H+-ATPase subunit D ... can be seen here [C] COG1269 Archaeal/vacuolar-type H+-ATPase subunit I ... can be seen here     ..................................................................................................................