                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:111 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-22.90 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -4.90 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G= -9.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGTGTTTGTTCGCAAATGATTGCTTCCTATGAAGTTGTTTTCTCTCAAATGATGCATC
CTGTTACCAAACGTTGGGTTTCTTTGACTGAGGGGTGGACCGAAGGAGGTTAAgcagagaa
gagattagtaattcgcgaacgatgataaagctctttgttagacctaaaggtctagtaaagagcttttttttgactcgatcacaagttttttagttcatgg
caatgaggggattgggtcgtttagaagcatttgtggttgttaaataacaattttaaaggggggcgcctttagggagaagatATG

    CT326.1 --- CT326 Gene: CT326.1     GI: 15605048     BI number: CT326.1     GOG: -------     Description: hypothetical protein Gene: CT326     GI: 15605047     BI number: CT326     GOG: NOG09341     Description: hypothetical protei AG A  G G  A CG CG                  aa AT        ga       t  a GT       c  a       cg G  A       gc        cg T  A       cg        at G  g       ta        gc G  |      t  t       at G  |      a  g       ta G  |      a  |       tg A  |       ta        gt Gc        gt        ta Ta       a  a       ta Cg        ta        ta A  a       ta        cg G  |      a  g       ta Tg        gc        cg Ta        at        gc Ta        gc        at Cg        at        at Ta        at        at                         tttttgactcgatcacaagttttttagttcatggcaatgaggggattgggtcgtttagaagcatttgtggttgttaaataacaattttaaaggggggcgcctttagggagaagatATG     ..................................................................................................................