                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:91 nt.    Distance to gene:68 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G= -8.80 kcal/mol
Antiterminator:    Distance from promoter:57 nt. Size=46 nt.     Delta G=-11.90 kcal/mol
Anti-antiterminator:    Distance from promoter:24 nt.    Size=47 nt.     Delta G= -8.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGCCA-GATAGT. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCCATTTCAGAAATGCTTTCTGATAGTCATTATCATACGTTTTTACTCTGGCTGGA
ACAGTATCTTTTATCTCAAAAACCTTAGaaggctagttttagaaaaaaagtacgcttttcttctctttagctttgaaaa
gaagctctaagggtttattatcgtattcttttgattggatttagcttatcatcattttgtttttacacgtacagggaagaatactATG

    ptsH --- ptsI Gene: ptsH     GI: 15605060     BI number: CT337     GOG: COG1925     Description: PTS Phosphocarrier Protein Hpr Gene: ptsI     GI: 15605059     BI number: CT336     GOG: COG1080     Description: PTS PEP Phosphotransferas AA A  A       ac C  A      t  g T  C       gc C  C       at T  T       at AT        at TA        at TG       a  c Ta        at         a Ta        at       a  a Cg        gc       g  a T  |       at        tg A  |      t  c       ta Tg       t  t       ta Gc       t  |       cg At       t  |       gc |  a       gt        at Cg        at       |  c At        ta       t  t At        cg        ta Gt        gc        ta Gt        gt        cg Ta        at        tg Cg        at        cg                         tttattatcgtattcttttgattggatttagcttatcatcattttgtttttacacgtacagggaagaatactATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1925 Phosphotransferase system, HPr-related proteins ... can be seen here [G] COG1080 Phosphoenolpyruvate-protein kinase (PTS system EI component in bacteria) ... can be seen here     ..................................................................................................................