Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:46 nt.    Distance to gene:114 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-17.10 kcal/mol
Antiterminator:    Distance from promoter:14 nt. Size=44 nt.     Delta G= -9.80 kcal/mol
Anti-antiterminator:    Distance from promoter:21 nt.    Size=14 nt.     Delta G= -4.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: atgcat-tagact. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atgcattaaaaaatcctttcatttagactggagaaagtttttctgggcaaatctccatggagatcgtttccagaaagcttcgcgccatatttatattatg
gtgcggctgcttttttccttctgtagctatccttatctaggcaaaacttcagaggaagttgaaggatgtctgtagttggtttaaaggccggataccttag
tgtcgattcggtgaatttgtggaagggatATG

    CT359


Gene: CT359     GI: 15605083     BI number: CT359     GOG: COG1268     Description: hypothetical protei


            c
          t  g
           at
           gt
           at         a
           gc       t  t
           gc       t  a
           ta       t  t
          a  g       at
          c  a       ta
          c  a       at
           ta        cg
           cg        cg
          t  c       gt
           at        cg
           at        gc
 at       a  c       cg
c  g       cg        tg
 cg        gc       |  c
 ta       |  g      t  t
 cg        gc        cg
 ta        gc        gc
 at        ta        at
                        tttttccttctgtagctatccttatctaggcaaaacttcagaggaagttgaaggatgtctgtagttggtttaaaggccggataccttagtgtcgattcggtgaatttgtggaagggatATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG1268 Uncharacterized conserved protein ... can be seen here

    ..................................................................................................................