                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:78 nt.    Distance to gene:35 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-19.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTCTTA-tatagt. It has a score value of 66.93 and is shown in blue

TTCTTAGCGTATGCCGGCAGTGAtatagtgaggatcatcactaaataataagtttgattttggcagataggaaaagcctatct
gtcttctaaaatgagatgaactgtgccctttattacgtctttttacagaggtaataaagggtttttgtgtctatattcaatagggagatttcactacatt
tATG

    CT360 Gene: CT360     GI: 15605084     BI number: CT360     GOG: NOG11803     Description: hypothetical protei           tt          t  a          t  c           ta           cg           ta          g  g           cg           at           ta           ta           at           ta           ta           ta           cg           cg           cg           gt             ttttgtgtctatattcaatagggagatttcactacatttATG     ..................................................................................................................