                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:51 nt.    Distance to gene:161 nt.     Distance to run of Ts=3 nt.   Size=29 nt.     Delta G=-13.90 kcal/mol
Antiterminator:    Distance from promoter:42 nt. Size=19 nt.     Delta G= -3.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGGAA-TAATGT. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGAATTGCTTGCGCATTCAATAATGTACACCTCTCTGCTTCTCCAAATACTAAAAG
AAAATACGAAACTGTAATCGAAGGGTTTGCAACTATCGGTTGCGGCCCCTATCTTTCT
TTCGCTCCAGACTTCCAACTCTACCTCTACCCAGCTCTTCGTCCAAACAAACAATCTG
CCCGTGTTTATAGCGTGCGAGCTAATTTAGCTATCTAAtctgtagattagcacaaaaacgcttgcatccttg
tggttaaccatttaccaacgaaaaaggaggccctATG

    CT373 --- arcD Gene: CT373     GI: 15605097     BI number: CT373     GOG: COG1945     Description: hypothetical protein Gene: arcD     GI: 15605098     BI number: CT374     GOG: COG0531     Description: Arginine/Ornithine Antiporte             T           A  C           T  G            CG            AT AA        AT G  G       CG CG        GC TG        TG |  T      T  G AT       T  C AT        GC TG        GC GC        GC TA        AT             ATCTTTCTTTCGCTCCAGACTTCCAACTCTACCTCTACCCAGCTCTTCGTCCAAACAAACAATCTGCCCGTGTTTATAGCGTGCGAGCTAATTTAGCTATCTAAtctgtagattagcacaaaaacgcttgcatccttgtggttaaccatttaccaacgaaaaaggaggccctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1945 Uncharacterized conserved protein ... can be seen here [E] COG0531 Amino acid transporters ... can be seen here     ..................................................................................................................