Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:73 nt.     Distance to run of Ts=2 nt.   Size=25 nt.     Delta G= -8.30 kcal/mol
Antiterminator: Size=75 nt.     Delta G=-22.40 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-11.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGCTTTTTATGAGCATAAATTTGCATTTCAAGGGTTTTGCTGGGGAATCAATTCTT
TTGACCAAGAAGGGGTTTCATTAGGGAAAGAATTGGCAACGCAAATTATAGGCATCAT
GTCGGGGAATGCTCCTGTAGAGTTTTCCGAAGCTCGAGGTATGTTAAGACTTTTTAAC
GTTTTAACATAAagtgctttctacggagacggctaggcaaagtttttttgtttgcagagtttttattttaaatatgttataatctgtctat
tacttctctcttaaaatcgtttttttaggggctttATG

    ltuA


Gene: ltuA     GI: 15605101     BI number: CT377     GOG: NOG09484     Description: hypothetical protei


           TT
          T  A
          T  A
          T  C
           CG
           AT
           GT
           AT
           AT
           TA
           TA
           GC
           TA
           AT
           TA
  G       G  A
T  T      G  a
C  A      A  g
 CG       G  t
 TA       C  |
 CG       T  |
 GT        Cg
T  T       Gc
 AT        At
 AT        At
 GC       G  |
 GC       C  |
|  G      C  |
|  A      T  |
|  A      T  |
|  G      T  |       ag
|  C      T  |      g  a
 GT       G  |       gc
 GC        At        cg
 CG        Gc       a  g
 TA        At       t  c
G  G       Ta       c  t
 TG        Gc       t  |
 AT       T  |       ta
C  |       Cg        tg
 TA        Cg        cg
 AT        Ta        gc
 CG        Cg        ta
                        aagtttttttgtttgcagagtttttattttaaatatgttataatctgtctattacttctctcttaaaatcgtttttttaggggctttATG


    ..................................................................................................................