                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:125 nt.    Distance to gene:91 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-20.00 kcal/mol
Antiterminator:    Distance from promoter:63 nt. Size=67 nt.     Delta G=-14.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTAACT-TATTGT. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTAACTTGTAGTTTGCTTTGTTATTGTAGGAAACTACTCAAAGGAAGAGCTGAATATG
CTGATGAGGCGCTATTTCAAGCTTTTCTTACGACGCTGATAGATGTAATTTCTGATAT
TAAACAGTTGCCTAACGGATCAGAATAGcatcattaaacgttctcttctcttcaagagaagagggcgtttttttcattg
aaaaatctttctatttcttttctcttccctgtgtgtatgatttgctgttcatgagttaagagaagaaacaaggaaaacaaatctaATG

    aroG Gene: aroG     GI: 15605106     BI number: CT382     GOG: COG2876     Description: phospho-2-dehydro-3-deoxyheptonate aldolas AA T  C CG CG G  | T  | T  | G  | A  | C  | A  | A  | A  | T  | T  | A  | TA AT GC TA CG TA TA T  T A  A        c A  |      t  a TG       t  a Gc        cg Ta        ta At        cg Gc        ta A  |       ta Ta        cg At        ta Gt        cg Ta        tg |  a       tg C  a       gc Gc        cg Cg        at At        at             tttttcattgaaaaatctttctatttcttttctcttccctgtgtgtatgatttgctgttcatgagttaagagaagaaacaaggaaaacaaatctaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG2876 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase ... can be seen here     ..................................................................................................................