                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:53 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-21.30 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -5.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACTACCAATGGCTGTTCAGTTCCAACCTCTGCACACACATTGGCAAATCAATTGATTC
TTCGCTATAAAGCATGTTCCTTATACATCACGGCATATACTATCAACCGTGAAGGGAA
GAACCTCTCCAATAGCTTATCCTGCGGAGGCTATGTTGGCTTCTAAtataaccttggagatgaact
atttttaaaaacctctgtatcttcctagtaaattaggcaaggaataccttgcctaatttacttttctgatttatctaacgcctatcgagttcgtacatat
tcaataggtttgtcttctATG

    pmpB Gene: pmpB     GI: 15605138     BI number: CT413     GOG: NOG43380     Description: Putative outer membrane protein            at aa       a  a t  a       gc gt        gc at        at ta        at cg        cg cg        gc |  c       gc ta        at ta        ta cg        ta tg        at a  a       at ta        at gt        ta ta        gc             ttttctgatttatctaacgcctatcgagttcgtacatattcaataggtttgtcttctATG     ..................................................................................................................