                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:48 nt.     Distance to run of Ts=1 nt.   Size=18 nt.     Delta G= -6.30 kcal/mol
Antiterminator: Size=22 nt.     Delta G= -4.40 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G= -5.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGACATTACTTTTTTGGATATGAAAATCGAAGACGCCTTTAAATATGTAATCTCTTG
TGGAGTATTAAACTCAGATCCCTGCGCTACCTCACCTTTCATACACCCACAGTCTTAG
tccccctaatcattatcttctttttaaaaagaagggaatttagtgggaaccagactcatagctctattgaaaaaaaaacggcgctctactattctgttcc
tttcataagcaacagcagagttgctattttctttttaaatcccttcccattcaggaaggcagaaggatcttgttgggttattttATG

    CT421.1 --- CT421.2 --- CT422 Gene: CT421.1     GI: 15605147     BI number: CT421.1     GOG: NOG09585     Description: hypothetical protein Gene: CT421.2     GI: 15605148     BI number: CT421.2     GOG: NOG08096     Description: hypothetical protein Gene: CT422     GI: 15605149     BI number: CT422     GOG: COG0319     Description: possible metalloenzym aa a  a a  a g  a ta ta a  c tg cg t  c cg gc at |  c |  t t  a a  c c  t       ca t  a      t  t c  t       ta        ca at        ta       g  g gc        cg       a  a at       c  c       cg c  |       ta        at cg        ta        at at        gc        cg at        ta        gc gc        cg        at                         attttctttttaaatcccttcccattcaggaaggcagaaggatcttgttgggttattttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0319 Predicted metal-dependent hydrolase ... can be seen here     ..................................................................................................................