                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:34 nt.     Distance to run of Ts=3 nt.   Size=32 nt.     Delta G=-15.10 kcal/mol
Antiterminator: Size=14 nt.     Delta G= -3.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTAAGTACCTTTCTTCCCCATAAAACTATTATTCTCACTAGCCCTTCTATCGTTCGTG
CCTATGCACAACTATTTCCCTGCCTCCCTGATAAAGAACACTGGTGTCTAGGAGAGAT
TAGTGCAGCAGAATTCAAACAGATATTTCACACTCCTCCTTCCAAAATTCTTTTTTCA
ACTAAAGAACCGACAGGATGTTGAtaacaatctttctatttattttaatgaagatctcttcaagaagttgtgaagagatctt
acctcttttagagggcatataattcctgtcccctttgcaagcacATG

    ygbB Gene: ygbB     GI: 15605161     BI number: CT434     GOG: COG0245     Description: YgbB famil            ag           a  t           g  t           a  g            at            cg            ta            ta            cg tc        ta a  t       cg gc        ta at        at at        gc gc        at ta        at             acctcttttagagggcatataattcctgtcccctttgcaagcacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG0245 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase ... can be seen here     ..................................................................................................................