                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:120 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-19.50 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -7.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGTAGAGTTTTCTGTAACATTGAAAGCAGTATCAGCTGGAGATGCTCGTGGGGAAGC
GATTCTTTCTTCCGATACATTGACTGTTCCAGTTTCTGATACAGAGAATACACACATC
TATTAAtctttgattttatcgatgtgtaggtgccgtccagggattcctgggcggcttttttttgttatctatatgaaaataaaagagttcattttc
ggtctcagagcatattctagatgggtttttgaaaaaaacaagtgtttgtgtagactccctgctcacaaccaaaaaaggaatgtaaaatATG

    crpA Gene: crpA     GI: 15605168     BI number: CT442     GOG: NOG08722     Description: 15kDa Cysteine-Rich Protei gt t  g a  t g  a cg tg at tg t  c t  c       at tg       g  t at        gc |  c       gc gc        at ta        cg tg        cg tg        tg cg        gc ta        cg At        cg At        gc             ttttttttgttatctatatgaaaataaaagagttcattttcggtctcagagcatattctagatgggtttttgaaaaaaacaagtgtttgtgtagactccctgctcacaaccaaaaaaggaatgtaaaatATG     ..................................................................................................................