                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:191 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-23.90 kcal/mol
Antiterminator: Size=21 nt.     Delta G=-10.50 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G=-15.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGCAGACGCAGAAAATTTTATCTCATAGagatagagccttctctgtaagggcacagcaggggagagcttgggcctcct
ccggaattccggaggggggctttttttttgttgaaaaagagctccgaaaaactcgttattttagttttgttaaagtcgccaagaatgaatctctctggta
tcgtttaggaacatagggctttgaacggtccgattttatgcctgattcataggacaggaacccgggacggggtgttcatttcataaagatagaaaagttt
cctttcctgggttagtagcgaATG

    gltX Gene: gltX     GI: 15605172     BI number: CT445     GOG: COG0008     Description: Glutamyl-tRNA Synthetas   g g  c g  a a  c a  a                 at tg                 a  t gc                  gc ta                  gc cg        tg        cg tg       t  g       cg cg        cg        ta tg        gc        cg ta       a  |       cg cg        gc        tg |  a       at        cg cg        gc        cg gc        gc       g  g at        gt        gc gt        gc        gt                         ttttttttgttgaaaaagagctccgaaaaactcgttattttagttttgttaaagtcgccaagaatgaatctctctggtatcgtttaggaacatagggctttgaacggtccgattttatgcctgattcataggacaggaacccgggacggggtgttcatttcataaagatagaaaagtttcctttcctgggttagtagcgaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0008 Glutamyl- and glutaminyl-tRNA synthetases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_trachomatis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:197 nt.     Distance to run of Ts=1 nt.   Size=24 nt.     Delta G=-20.20 kcal/mol Antiterminator: Size=21 nt.     Delta G=-10.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TGGCAGACGCAGAAAATTTTATCTCATAGagatagagccttctctgtaagggcacagcaggggagagcttgggcctcct ccggaattccggaggggggctttttttttgttgaaaaagagctccgaaaaactcgttattttagttttgttaaagtcgccaagaatgaatctctctggta tcgtttaggaacatagggctttgaacggtccgattttatgcctgattcataggacaggaacccgggacggggtgttcatttcataaagatagaaaagttt cctttcctgggttagtagcgaATG     gltX Gene: gltX     GI: 15605172     BI number: CT445     GOG: COG0008     Description: Glutamyl-tRNA Synthetas            at aa       a  t t  g       gc gg        gc tg        cg c  |       cg tc        ta ca        cg tc        cg ta        tg cg        cg cc        cg             gctttttttttgttgaaaaagagctccgaaaaactcgttattttagttttgttaaagtcgccaagaatgaatctctctggtatcgtttaggaacatagggctttgaacggtccgattttatgcctgattcataggacaggaacccgggacggggtgttcatttcataaagatagaaaagtttcctttcctgggttagtagcgaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0008 Glutamyl- and glutaminyl-tRNA synthetases ... can be seen here     ..................................................................................................................