                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:104 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G= -9.90 kcal/mol
Antiterminator: Size=65 nt.     Delta G=-10.24 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G= -8.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gggtgtggtccagggaacgctttcctggtcgagtcgccgggcgagagttttcggttggttttggtagacaagcattgaaagctaccgtgttgtccaaaaa
attgcagaaaagattccaatccaaatttgtctctggacatcaaaaaatgggggagactccgggctccttctcttgtcattgagagggctttcttttgtca
acatatatgttttgaagagcctagatcttccttcccgctgcttgagcgttgggctaagtagctgcattcgcagaattcacgaataacgaagagcctcata
ATG

    secD/secF Gene: secD/secF     GI: 15605175     BI number: CT448     GOG: COG0341,COG0342     Description: Protein Expor            aa           a  a           c  a            ta cc        at t  a       cg ta       a  g at       g  g gc       g  | |  c       tg a  a       cg a  a       ta a  a       cg at        ta gt        gc at       t  t cg       t  c gt       t  c t  c      a  g       tc t  t      a  |      g  a a  c      a  |      t  t a  |       cg       t  t a  |       cg        cg a  |      t  c       ta a  |      a  t       cg at       a  c      t  | cg       c  c       ta cg       c  t       cg ta       t  t       cg gc       t  c      t  | ta        at        cg t  t       gc        gc gc        at        gt ta        at        gt                         tcttttgtcaacatatatgttttgaagagcctagatcttccttcccgctgcttgagcgttgggctaagtagctgcattcgcagaattcacgaataacgaagagcctcataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG0341 Preprotein translocase subunit SecF ... can be seen here [U] COG0342 Preprotein translocase subunit SecD ... can be seen here     ..................................................................................................................