Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:206 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-15.60 kcal/mol

                                                                        Nomenclature/Definitions

GCGAAGGGGAAGAAGGTGGAGACGAAACTAGAGATCCTATTATTCTATAGttttttctaaaag
agagttgaattttcaactctctttttttttcttaaaagattctctataccagctccttcctaaatattttttgaaatatttctttcagtaagtcgatcat
cttgtttgtaagaggaaaaagcttttcttttgctataattcgctagttactagaattcaaaacccagattgataagagtattctagacctgtcttgagac
tttttggtgcgttttcaacgaatagaggagacaacgcATG

    oppA_4 --- oppB_2 --- oppC_2


Gene: oppA_4     GI: 15605207     BI number: CT480     GOG: COG0747     Description: oligopeptide Binding Lipoprotein
Gene: oppB_2     GI: 15605206     BI number: CT479     GOG: COG0601     Description: Oligopeptide Permease
Gene: oppC_2     GI: 15605205     BI number: CT478     GOG: COG1173     Description: Oligopeptide Permeas


          tt
         a  t
          at
          gc
          ta
          ta
          gc
          at
          gc
          at
          gc
          at
          at
          at
          at
            tttttcttaaaagattctctataccagctccttcctaaatattttttgaaatatttctttcagtaagtcgatcatcttgtttgtaagaggaaaaagcttttcttttgctataattcgctagttactagaattcaaaacccagattgataagagtattctagacctgtcttgagactttttggtgcgttttcaacgaatagaggagacaacgcATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0747 ABC-type dipeptide transport system, periplasmic component ... can be seen here
[EP] COG0601 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here
[EP] COG1173 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here

    ..................................................................................................................