                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:84 nt.     Distance to run of Ts=1 nt.   Size=33 nt.     Delta G=-18.90 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -6.00 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G=-10.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGTTGGATCTTTGTGATCGCTTGGTTAGGTAGAGAGTACACAGCCAAGACCGAGGCTC
TTTTTAGAGTCAATGTTTCTGAAGAAGATGTTTTACAGGAAGAGCGAGAGGCTTCTTC
TTTAGTAGATGCTGAGTCTCGAGAAGAACCTGTAACAACTTTATAGtcttgagaagaaaaggacct
ggagtatagtattccaggtcttttaatttttatttaaaaattctttttataatccccctgttttagtaccgttttgttgctaatgctaaaagcgattaat
agatttattagggtttgcATG

    sohB --- polA --- yacE --- rho Gene: sohB     GI: 15605222     BI number: CT494     GOG: COG0616     Description: Protease Gene: polA     GI: 15605221     BI number: CT493     GOG: COG0258,COG0749     Description: DNA Polymerase I Gene: yacE     GI: 15605220     BI number: CT492     GOG: COG0237     Description: predicted phosphatase/kinase Gene: rho     GI: 15605219     BI number: CT491     GOG: COG1158     Description: Transcription Termination Facto             a           a  g           g  a           a  a   A       g  a A  C       ta C  T       tg AT        cg AT        ta TA        Gc         a GT       A  c      t  g TA       T  |       at CG        At        ta C  |       Tg        gt A  |       Tg        at A  |       Ta        gc G  |       Cg        gc A  |       At        ta At       A  |       cg Gc       C  |       cg At       A  |       at Gt       A  |       gc Cg        Ta        gt Ta        Gt        at Cg        Ta        at Ta        Cg        at                         aatttttatttaaaaattctttttataatccccctgttttagtaccgttttgttgctaatgctaaaagcgattaatagatttattagggtttgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [OU] COG0616 Periplasmic serine proteases (ClpP class) ... can be seen here [L] COG0258 5'-3' exonuclease (including N-terminal domain of PolI) ... can be seen here [L] COG0749 DNA polymerase I - 3'-5' exonuclease and polymerase domains ... can be seen here [H] COG0237 Dephospho-CoA kinase ... can be seen here [K] COG1158 Transcription termination factor ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_trachomatis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:96 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-10.30 kcal/mol Antiterminator: Size=46 nt.     Delta G= -6.00 kcal/mol Anti-antiterminator:   Size=39 nt.     Delta G=-10.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AGTTGGATCTTTGTGATCGCTTGGTTAGGTAGAGAGTACACAGCCAAGACCGAGGCTC TTTTTAGAGTCAATGTTTCTGAAGAAGATGTTTTACAGGAAGAGCGAGAGGCTTCTTC TTTAGTAGATGCTGAGTCTCGAGAAGAACCTGTAACAACTTTATAGtcttgagaagaaaaggacct ggagtatagtattccaggtcttttaatttttatttaaaaattctttttataatccccctgttttagtaccgttttgttgctaatgctaaaagcgattaat agatttattagggtttgcATG     sohB --- polA --- yacE --- rho Gene: sohB     GI: 15605222     BI number: CT494     GOG: COG0616     Description: Protease Gene: polA     GI: 15605221     BI number: CT493     GOG: COG0258,COG0749     Description: DNA Polymerase I Gene: yacE     GI: 15605220     BI number: CT492     GOG: COG0237     Description: predicted phosphatase/kinase Gene: rho     GI: 15605219     BI number: CT491     GOG: COG1158     Description: Transcription Termination Facto             a           g  g           t  a           t  a   T       c  g C  G       ta G  A       Ga TG        Aa AT        Ta GC        Ag AT       T  g T  C      T  | G  |       Ta A  |       Cc T  |       Ac TG        At         a TA        Cg       t  g CG        Ag        at TA       A  |       ta TA       T  |       gt CG       G  |       at TA       T  |       gc TA        Ca        gc C  |       Cg        ta GC        At        cg GC        Aa        cg                         tcttttaatttttatttaaaaattctttttataatccccctgttttagtaccgttttgttgctaatgctaaaagcgattaatagatttattagggtttgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [OU] COG0616 Periplasmic serine proteases (ClpP class) ... can be seen here [L] COG0258 5'-3' exonuclease (including N-terminal domain of PolI) ... can be seen here [L] COG0749 DNA polymerase I - 3'-5' exonuclease and polymerase domains ... can be seen here [H] COG0237 Dephospho-CoA kinase ... can be seen here [K] COG1158 Transcription termination factor ... can be seen here     ..................................................................................................................