                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:175 nt.     Distance to run of Ts=1 nt.   Size=31 nt.     Delta G= -9.20 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-14.50 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-11.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttcggagctttttgggccggttgtttcgttGGAAAGATGACTGAGTGGTCGAAAGTACGTCCCTGCTAAG
GACGCGTACCCCTTAAAGGGTACCGAGGGTTCGAATCCCTCTCTttccgtttctttacattgtgttt
tctgaaatttttgtttgtttgaatgttttttgttgataagctgggggaaatggcgggaaacatagctaaactctctgcttgcttttggagtgtctatgtt
tcataatatgtgtcattgcgctggaggctaagaattttcaagacaagcttccgaatcaacgttATG

    pgsA_1 Gene: pgsA_1     GI: 15605224     BI number: CT496     GOG: COG0558     Description: CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferas            TA           T  A CT       C  A G  A       CG TA        CG CG        CG CG        AT |  A       TA C  C       GC TG       C  | GC        GC CG        CG AT       A  |        G TA       G  |      C  A GC       G  |      T  A A  |      A  |      T  T A  |      A  |       GC A  |      T  |       GC G  |      C  |       GC C  |      G  |       AT T  |       TA        GC GC        CG       C  T GC        CG       C  C T  |       CG       A  T GC       |  T      T  t AT       T  T       Gt GT        GC        Gc TA        CG        Gc                         gtttctttacattgtgttttctgaaatttttgtttgtttgaatgttttttgttgataagctgggggaaatggcgggaaacatagctaaactctctgcttgcttttggagtgtctatgtttcataatatgtgtcattgcgctggaggctaagaattttcaagacaagcttccgaatcaacgttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG0558 Phosphatidylglycerophosphate synthase ... can be seen here     ..................................................................................................................