Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:48 nt.    Distance to gene:168 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-19.40 kcal/mol
Antiterminator:    Distance from promoter:16 nt. Size=43 nt.     Delta G= -7.50 kcal/mol
Anti-antiterminator:   Size=77 nt.     Delta G=-12.37 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgctt-tacaat. It has a score value of 67.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgcttttttttagaactttaacatacaatccattgtagcttttccagtcgtgcgtgctagaacttcttgtaaagctgtggcgaggactctttagggtcc
tcgtcgtttttGCTCAGATGGTGGAATGGTAGACACTAGGGACTTAAAATCCCTTGGGCTTT
GGCCCGTGCAAGTTCGAGTCTTGTTCTGAGCAcatcttttttctctggttcttgagacaataatacctttttgatt
tatagatgaggagagctatttaactcggggtatctttttgATG

    CT503


Gene: CT503     GI: 15605232     BI number: CT503     GOG: NOG06347     Description: hypothetical protei


 cc
t  a
 at
 at
 cg
 at
 ta
|  g
a  c
c  t
a  t
a  t
t  t
t  c
t  c
c  a
a  g
 at         c
 gc       t  t
a  g      t  t
t  t       cg
t  g       at
t  c      a  a
t  g      g  a
t  t      a  |
t  |       ta
t  |       cg
t  |       gc        tt
 cg       |  t      t  a
 gc       |  g       cg
t  t      t  t       tg
t  a      g  g       cg
a  |       cg        at
 cg        gc        gc
 ta        tg        gc
 ta       |  a       at
 gc       g  g       gc
 at        cg        cg
 at        ta        gt
 gc        gc        gc
 At        at        tg
                        tttttGCTCAGATGGTGGAATGGTAGACACTAGGGACTTAAAATCCCTTGGGCTTTGGCCCGTGCAAGTTCGAGTCTTGTTCTGAGCAcatcttttttctctggttcttgagacaataatacctttttgatttatagatgaggagagctatttaactcggggtatctttttgATG


    ..................................................................................................................