                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:140 nt.     Distance to run of Ts=1 nt.   Size=29 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -8.00 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G= -9.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCATACTTCCCTGGGAATCGAGAACTTGCCCAGTTTCTACAGGAGTACTCCAAGTTTC
CGTCCCTCTTTACAGTTATCATACTGTATATGCAAGGCTGGGTGATGCTCCTCTGTTA
CTGATTGCAGTTTGTTCGGTTATCGGAGCGATTGCCTATTTTTATAGGAAAAAGAAAG
AGACCCCACCACAAACATTTTTTTGAgatagcaagtgttttagaactaggtagtaattttttgatatcgcttgcttgctaa
aaaaaaaaaaggataatatacggggtctctttgtcagggttttgcATG

    lpxC --- fabZ --- lpxA --- fmt Gene: lpxC     GI: 15605262     BI number: CT533     GOG: COG0774     Description: UDP-3-O-Acyl GlcNAc Deacetylase Gene: fabZ     GI: 15605261     BI number: CT532     GOG: COG0764     Description: Hydroxymyristoyl-(acyl carrier protein) dehydratase Gene: lpxA     GI: 15605260     BI number: CT531     GOG: COG1043     Description: Acyl-Carrier UDP-GlcNAc O-Acyltransferase Gene: fmt     GI: 15605259     BI number: CT530     GOG: COG0223     Description: Methionyl tRNA Formyltransferas TC A  A T  T TA GC         T AT       T  A CG       G  C AT       T  T TA        CG |  T       TA |  A      C  T |  T      C  T |  G      T  | |  C       CG        TA TA        GC       T  T TA        TA       G  C CG       |  G      G  G |  G      |  T       CG |  C       AT        TA |  T       GT        TG TG        TG        GC CG       G  T      T  | CG       G  T       TG |  T       GC        TA CG        TG        GT TA        CG        AT GT        GT        CG CG        GT        GC                         CTATTTTTATAGGAAAAAGAAAGAGACCCCACCACAAACATTTTTTTGAgatagcaagtgttttagaactaggtagtaattttttgatatcgcttgcttgctaaaaaaaaaaaaggataatatacggggtctctttgtcagggttttgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0774 UDP-3-O-acyl-N-acetylglucosamine deacetylase ... can be seen here [I] COG0764 3-hydroxymyristoyl/3-hydroxydecanoyl-(acyl carrier protein) dehydratases ... can be seen here [M] COG1043 Acyl-[acyl carrier protein]--UDP-N-acetylglucosamine O-acyltransferase ... can be seen here [J] COG0223 Methionyl-tRNA formyltransferase ... can be seen here     ..................................................................................................................