                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:145 nt.     Distance to run of Ts=1 nt.   Size=32 nt.     Delta G=-13.80 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -3.70 kcal/mol
Anti-antiterminator:   Size=27 nt.     Delta G= -3.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

agaaatgattttcttgctcgacatagaagtttttcatttgaattcaaagtcttattgaaaaacgtaatgagcttgtgcctaacggaaaatcatgatagca
tgtagtcgattcaggatgcccctacccctagagcatggggaggttaggcctgttttgctttttgtaaaaatacttttgcaaggaagtgagagtaggtaga
gaacagggatatgggcggaaaggcttccctttagaaggaggctggtgattaaaagaagaatcagtttgccattaagcaactgaaaaaagtaaggataagt
ATG

    CT538 --- yjeE --- dnaQ_2 Gene: CT538     GI: 15605267     BI number: CT538     GOG: NOG05151     Description: hypothetical protein Gene: yjeE     GI: 15605266     BI number: CT537     GOG: COG0802     Description: (ATPase or Kinase) Gene: dnaQ_2     GI: 15605265     BI number: CT536     GOG: COG0847     Description: DNA Pol III Epsilon Chai             g           t  t           a  a            cg        ag            gt       g  c           |  c      a  a aa       |  g      t  t t  c      a  a       cg cg       t  t       cg cg        at        cg g  a       gc        cg t  |       ta       a  | g  |      a  g       ta ta        cg        cg ta        ta        cg c  a       at       |  t g  |      a  g      |  t at       a  |      |  a gc       a  |       cg ta        gc        cg at        gc        gc                         ctgttttgctttttgtaaaaatacttttgcaaggaagtgagagtaggtagagaacagggatatgggcggaaaggcttccctttagaaggaggctggtgattaaaagaagaatcagtttgccattaagcaactgaaaaaagtaaggataagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0802 Predicted ATPase or kinase ... can be seen here [L] COG0847 DNA polymerase III, epsilon subunit and related 3'-5' exonucleases ... can be seen here     ..................................................................................................................