                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:123 nt.     Distance to run of Ts=1 nt.   Size=22 nt.     Delta G= -9.60 kcal/mol
Antiterminator: Size=15 nt.     Delta G= -5.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aaccttttattaaaacagctttctctctatactggcctctcatGCAGCTATGGCGGAACCGGTAGACGCGCTAGAT
TCAGGTTCTAGTGAGCTTTTGCTCATGGAAGTTCAAGTCTTCTTAGCTGCAaacttcttttc
aacaaacgcccgggacaggggcatctgtcttgactttttcgtagaggttatggctaactggcctttcagaacacggctagccccgtttgcttgcggttct
tagggaagccctgaaacctcctagcaaggatttacatagattttaaattaggaacaagttttATG

    trxA Gene: trxA     GI: 15605268     BI number: CT539     GOG: COG0526     Description: Thioredoxi            gc           g  a            gt   a        gc g  c       at g  a       cg g  g       at cg        gc cg        gt cg        gt gc        cg             actttttcgtagaggttatggctaactggcctttcagaacacggctagccccgtttgcttgcggttcttagggaagccctgaaacctcctagcaaggatttacatagattttaaattaggaacaagttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [OC] COG0526 Thiol-disulfide isomerase and thioredoxins ... can be seen here     ..................................................................................................................