                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:183 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -7.60 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -7.90 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G= -4.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGTTCGCTTATGAAAGAAGAGAATGAAAAACATACCTCTTGGATGGCCTCCCAAGGA
TGGAAATGCGTGAAAGAAGTGAAAATTCCGCTAGTTTCCCGACAAGGGGATGCTTTTT
TCTCGTCGCATTTTATCCGATCTCGCTCGCTCTAGaatcttgatcttaaaccatcagtgcaggtactataggac
gagggctaacggacgtttcttctaattcatcctttattctttccaaagaacttctgtgacttgggaaggatgatatgccctcttataagtaaaaattatc
attttttatcATG

    brnQ Gene: brnQ     GI: 15605283     BI number: CT554     GOG: COG1114     Description: Amino Acid (Branched) Transpor             T           G  G           A  A           A  A           G  A           A  A   A        AT C  A       AT CG        GC CG       T  | TA        GC        CA |  T       CG       A  A CG        GC       G  G CG       |  T       CG G  A      |  A       CG G  A       TG        CG TA        AT        TA AT        AT       T  T G  G       AT        TG GC        GC        GC TG        GC        AT                         TTTTTCTCGTCGCATTTTATCCGATCTCGCTCGCTCTAGaatcttgatcttaaaccatcagtgcaggtactataggacgagggctaacggacgtttcttctaattcatcctttattctttccaaagaacttctgtgacttgggaaggatgatatgccctcttataagtaaaaattatcattttttatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1114 Branched-chain amino acid permeases ... can be seen here     ..................................................................................................................