                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:209 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G= -6.70 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-11.90 kcal/mol
Anti-antiterminator:   Size=23 nt.     Delta G= -4.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTCACGCAGACATATTCCTGTGAAAAGCTATGTGTCTCCCGAGACTTTCGATTATTA
TCGCTCGGTAGGAGAGTCGTTAGGACTCTTTATTTATGCTGGCCCATTCGTTCGTTCT
AGCTTTAATGCGGATTCTGTTTTTGAAGCCATGCGCCAGCGGGAAACCTCAACCTCTG
CGCTACTTCCGAATAAAGATTAGccacataacctgttcattttgaagcattctctgcagaaaaaatgttcccgattggcacta
atctccccatttgctatggtgagtgaaaaggtgtgcgtgggttATG

    yscJ --- CT560 Gene: yscJ     GI: 15605288     BI number: CT559     GOG: COG4669     Description: Yop proteins translocation lipoprotein J Gene: CT560     GI: 15605289     BI number: CT560     GOG: NOG04995     Description: hypothetical protei            AT           T  T            TA            AT            GC            CG           T  |           T  |           T  |           C  |           A  |            GC            AT            GC            CG           |  G CC       |  T C  G      |  A TA        CG CG        CG         T TA        TA       T  A GC        CG       G  G T  T       TA        CG G  T      G  G       TA T  |      T  T       GC AT        GC        AT GC        TG        GC TG        AT        AT                         TTATTTATGCTGGCCCATTCGTTCGTTCTAGCTTTAATGCGGATTCTGTTTTTGAAGCCATGCGCCAGCGGGAAACCTCAACCTCTGCGCTACTTCCGAATAAAGATTAGccacataacctgttcattttgaagcattctctgcagaaaaaatgttcccgattggcactaatctccccatttgctatggtgagtgaaaaggtgtgcgtgggttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG4669 Type III secretory pathway, lipoprotein EscJ ... can be seen here     ..................................................................................................................