                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:72 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-14.90 kcal/mol
Antiterminator: Size=65 nt.     Delta G= -6.76 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G= -7.25 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATCGCCTTTTTCGGATGCCACGCTACAATTGAATATGGCTGTGACTGTAGAGCCGGG
GGTATATTTCCCTGGTGTAGGTGGGATCCGGATTGAAGATACGATCATGATAGGTGTG
AATGAAAATTTAAATTTAACAAACCGAAAGGTCTCTTCCGAGATAATTATCATTTAAt
ttcatataaaagccgatttttttgttttttaacaaaaaaacggcttttcttattttcttttgtaaaaattgattttttttctcaaatcagttactttata
caattcttttttgtttctctgttgttATG

    CT573 --- gspD --- gspE --- gspF Gene: CT573     GI: 15605302     BI number: CT573     GOG: NOG04443     Description: hypothetical protein Gene: gspD     GI: 15605301     BI number: CT572     GOG: COG1450     Description: Gen. Secretion Protein D Gene: gspE     GI: 15605300     BI number: CT571     GOG: COG2804     Description: Gen. Secretion Protein E Gene: gspF     GI: 15605299     BI number: CT570     GOG: COG1459     Description: Gen. Secretion Protein             A           C  T           T  T            AT            TA            TA            At            At AA       |  t G  A      T  c CG       A  a CG       G  t AT       A  a A  C      G  t A  T      C  a C  C      C  a A  T       Ta        tt A  T       Ta       t  t T  C       Cg        ta T  C      |  c       ta T  G      T  c       gc A  A       Cg        ta A  G       Ta        ta A  A       Gt        ta T  T       Gt        ta TA        At        ta TA        At        ta AT        At        ta AT        Gt       a  | A  A      C  t       gc AT        Cg        cg GC        At        cg TA        At        gc AT        At        at                         tttcttattttcttttgtaaaaattgattttttttctcaaatcagttactttatacaattcttttttgtttctctgttgttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NU] COG1450 Type II secretory pathway, component PulD ... can be seen here [NU] COG2804 Type II secretory pathway, ATPase PulE/Tfp pilus assembly pathway, ATPase PilB ... can be seen here [NU] COG1459 Type II secretory pathway, component PulF ... can be seen here     ..................................................................................................................