                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:160 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-20.10 kcal/mol
Antiterminator: Size=66 nt.     Delta G=-12.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAGAAAACAGCCCGCTTTCATTCAACAGGTGTTGGTAAACATTGCTTCTCTATTCTCT
GGTTATCTTTCTTAAcgtgtgattgaagtttgtgaattgagggggagccaaaaaagaatttcttttttggctcttttttcttttcaaag
gaatctcgtgtctacagaagtcttttcaataataagttcttagttccaaaagaagaaaatatgcttttttattcttctgggagaaagttgtaaaaaaaat
attattgggataggttcgcgacaagtacaactgtagagttgagagagttggcaATG

    CT621 Gene: CT621     GI: 15605352     BI number: CT621     GOG: NOG44662     Description: hypothetical protei ga t  a tg at gt |  t t  g g  t t  g g  a c  a At At Tg Ta Cg T  g        t T  g      a  t Tg       a  t Cg        gc Ta        at A  |       at T  |       at Tg        at Gc        at Gc        at Ta        cg |  a       cg |  a       gc |  a       at C  a       gc Ta        gt Cg        gt Ta        gt Ta        gt At        at             tcttttcaaaggaatctcgtgtctacagaagtcttttcaataataagttcttagttccaaaagaagaaaatatgcttttttattcttctgggagaaagttgtaaaaaaaatattattgggataggttcgcgacaagtacaactgtagagttgagagagttggcaATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_trachomatis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:167 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-11.90 kcal/mol Antiterminator: Size=66 nt.     Delta G=-12.60 kcal/mol Anti-antiterminator:   Size=58 nt.     Delta G= -8.76 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TAGAAAACAGCCCGCTTTCATTCAACAGGTGTTGGTAAACATTGCTTCTCTATTCTCT GGTTATCTTTCTTAAcgtgtgattgaagtttgtgaattgagggggagccaaaaaagaatttcttttttggctcttttttcttttcaaag gaatctcgtgtctacagaagtcttttcaataataagttcttagttccaaaagaagaaaatatgcttttttattcttctgggagaaagttgtaaaaaaaat attattgggataggttcgcgacaagtacaactgtagagttgagagagttggcaATG     CT621 Gene: CT621     GI: 15605352     BI number: CT621     GOG: NOG44662     Description: hypothetical protei            gg           g  g            ag            ga            tg           |  c   c       t  c A  g      a  a A  t      a  a T  g      g  a T  t      t  a Cg        ga Ta        ta T  t       tg T  t       ta Cg        ga Ta       a  t A  a      a  t T  g       g T  t       t G  t       t G  t      a  | T  g      g  | C  t       t         t T  |       g       a  t Cg        t       a  t Ta        g        gc Ta       |         at At       |         at T  t      |         at Cg       c         at Ta        A        at Cg        A        at Tg        T        cg Tg        T        cg Cg        C        gc                         tcttttttcttttcaaaggaatctcgtgtctacagaagtcttttcaataataagttcttagttccaaaagaagaaaatatgcttttttattcttctgggagaaagttgtaaaaaaaatattattgggataggttcgcgacaagtacaactgtagagttgagagagttggcaATG     ..................................................................................................................