                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:46 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-18.90 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -7.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAAACAAGGATTGGATCCTAAAGAATCTAACGGCTTTACTAACTATAAAGGAGTTTCC
TATCAGTTTGTTATGGGTCTGACAGATTCGGTTTCTTTCCGAGCTTATGCTGCTTATT
CTAAGCCTGCTAACGATAACCTTGGTAGCGACTTCACCTATCGTAAGTATGACCTAGG
TTTAATTTCTTCATTCTAAtcccttaagggatagtcttttaagagcccacacccaaaataacggatgtgggctttttttattgcct
tttataattaagtaaggtttttttattttttttatattgtATG

    CT622 Gene: CT622     GI: 15605353     BI number: CT622     GOG: COG0840     Description: CHLPN 76kDa Homolo ag a  g tg ta        at ct       a  a ca       a  a c  |      a  c tg        cg At        cg Ac       c  a |  t       at |  t       cg T  t       at C  t       cg T  a       cg T  a       cg Ag        gc Ca        at Tg        gt Tc        at Cc        at             tttattgccttttataattaagtaaggtttttttattttttttatattgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NT] COG0840 Methyl-accepting chemotaxis protein ... can be seen here     ..................................................................................................................