Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:34 nt.    Distance to gene:118 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G= -9.81 kcal/mol
Antiterminator:    Distance from promoter:12 nt. Size=35 nt.     Delta G= -4.00 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G= -5.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaaa-tacaaa. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaaaaacttgatgaccacctgtttacaaataggcataaccttttgttctaaacaatttaaacaagctgtgaacaaagttatgaacattattttcacag
ctttttctctcgaaataacaatgttataaacaatttccacaccccttaaagaagaagaaactaataaatatctctacgaatcttcttctaggggggtgga
aactttcgataagtgtacaactttATG

    hemB


Gene: hemB     GI: 15605364     BI number: CT633     GOG: COG0113     Description: Porphobilinogen Synthas


  t
a  a       aa         g
c  a      a  c      t  a
 gc        ta       a  a
 gc        ta       t  c
 at        tg       t  a
t  |      a  c      g  t
 at        at       a  t
 at        cg       a  a
 at        at       a  t
 cg       a  |      c  t
 at       a  |       at
|  t      t  |       at
|  c       cg        gc
|  t       ta        ta
 ta        ta        gc
 ta        gc        ta
 ta        ta        cg
 gc        ta        gc
 ta        ta        at
                        ttttctctcgaaataacaatgttataaacaatttccacaccccttaaagaagaagaaactaataaatatctctacgaatcttcttctaggggggtggaaactttcgataagtgtacaactttATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[H] COG0113 Delta-aminolevulinic acid dehydratase ... can be seen here

    ..................................................................................................................