                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:98 nt.     Distance to run of Ts=1 nt.   Size=29 nt.     Delta G=-12.70 kcal/mol
Antiterminator: Size=29 nt.     Delta G= -3.00 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G= -9.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aaagggtttagtgataacattagacccgtcctGGCCCCATCGTCTAGCCTGGCCCAGGACATCGGATTTTC
ATTCCGGTAACAGGGGTTCGAATCCCCTTGGGGTCAttacaaaaagaaatgcGGGTCTTTAGCT
CAGCGGTTAGAGCATCTCACTTTTAATGAGAGGGTCGAAGGTTCGAATCCTTCAAGAC
CCAtttctttctctaagagatcttccctcctcatcaaaaagatttccttcctttgtttttttctgttattgctgaaagtacctcgttgtatctgcacg
gctttcgatATG

    CT676 --- karG Gene: CT676     GI: 15605409     BI number: CT676     GOG: COG3880     Description: hypothetical protein Gene: karG     GI: 15605408     BI number: CT675     GOG: COG3869     Description: Arginine Kinas AG C  C TG CG GT AT TA TG TA CG |  C TA GT GC GT c  | gC tA         T         G a  |      A  G      C  A a  |      A  A      T  A a  |       TG       T  T gC        TA        GC aT        TG        GC aT        TG        AT aT        CG        AT a  |       AT        GC a  |      |  C      |  A c  |       CG       |  A aT        TA        CG tA       |  A       TA tA        CG        GC AT        TG        GC CG        AT        GC                         AtttctttctctaagagatcttccctcctcatcaaaaagatttccttcctttgtttttttctgttattgctgaaagtacctcgttgtatctgcacggctttcgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3880 Uncharacterized protein with conserved CXXC pairs ... can be seen here [E] COG3869 Arginine kinase ... can be seen here     ..................................................................................................................