                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:56 nt.    Distance to gene:139 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-14.50 kcal/mol
Antiterminator:    Distance from promoter:44 nt. Size=18 nt.     Delta G= -5.00 kcal/mol
Anti-antiterminator:    Distance from promoter:5 nt.    Size=49 nt.     Delta G=-12.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtag-tacgat. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtagaaaaattccattttttttacgattcgtagccaacaagtttttttcttaagggctgtttgacagtcctttccttgggtctagggagagacatcct
ctttccctaggctgtctttctttttttttcaagaaggtgttcgaaaaaaatatctcgaattgcagttcaggatttgttttgccttttttgagacagagga
gataataggctcttttctcacgagctccactccaaatagagtggcatcctgatgaaagaggaggatcATG

    CT684 --- CT685 --- CT686 --- yfhO_1 Gene: CT684     GI: 15605417     BI number: CT684     GOG: COG0719     Description: ABC Transporter Gene: CT685     GI: 15605418     BI number: CT685     GOG: COG0396     Description: ABC Transporter ATPase Gene: CT686     GI: 15605419     BI number: CT686     GOG: COG0719     Description: ABC Transporter Membrane Protein Gene: yfhO_1     GI: 15605420     BI number: CT687     GOG: COG0520     Description: NifS-related enzym   t t  g t  a gc ta cg gt gc gc at at t  t                 tc t  c                t  c c  |                t  c t  |                c  t t  |                 ta t  |                 cg t  |                 cg t  |                t  c t  |                 at t  |                 cg gc        gt        at at       g  c       gc at        gt        at cg        ta        gt a  |       tg        at a  |       cg        gc cg        cg        gt cg        ta        gt gt        tg        at                         ttttttcaagaaggtgttcgaaaaaaatatctcgaattgcagttcaggatttgttttgccttttttgagacagaggagataataggctcttttctcacgagctccactccaaatagagtggcatcctgatgaaagaggaggatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0719 ABC-type transport system involved in Fe-S cluster assembly, permease component ... can be seen here [O] COG0396 ABC-type transport system involved in Fe-S cluster assembly, ATPase component ... can be seen here [O] COG0719 ABC-type transport system involved in Fe-S cluster assembly, permease component ... can be seen here [E] COG0520 Selenocysteine lyase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_trachomatis                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:51 nt.    Distance to gene:143 nt.     Distance to run of Ts=3 nt.   Size=33 nt.     Delta G=-21.10 kcal/mol Antiterminator:    Distance from promoter:45 nt. Size=16 nt.     Delta G= -4.40 kcal/mol Anti-antiterminator:   Size=49 nt.     Delta G=-12.70 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgtag-tacgat. It has a score value of 66.27 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgtagaaaaattccattttttttacgattcgtagccaacaagtttttttcttaagggctgtttgacagtcctttccttgggtctagggagagacatcct ctttccctaggctgtctttctttttttttcaagaaggtgttcgaaaaaaatatctcgaattgcagttcaggatttgttttgccttttttgagacagagga gataataggctcttttctcacgagctccactccaaatagagtggcatcctgatgaaagaggaggatcATG     CT684 --- CT685 --- CT686 --- yfhO_1 Gene: CT684     GI: 15605417     BI number: CT684     GOG: COG0719     Description: ABC Transporter Gene: CT685     GI: 15605418     BI number: CT685     GOG: COG0396     Description: ABC Transporter ATPase Gene: CT686     GI: 15605419     BI number: CT686     GOG: COG0719     Description: ABC Transporter Membrane Protein Gene: yfhO_1     GI: 15605420     BI number: CT687     GOG: COG0520     Description: NifS-related enzym   a t  a t  g cg tg tc tt tg tt tt tt g  g a  a a  |                  t c  |                a  c a  |                c  c a  |                 at c  |                 gc c  |                 at g  |                 gt a  |                 at tc                  gc ga        gt        gc cg       g  c       gc tt        gt        at t  |       ta        ta a  |       tg        cg gc        cg        tg cc        cg        gc at        ta        gt                         gtctttctttttttttcaagaaggtgttcgaaaaaaatatctcgaattgcagttcaggatttgttttgccttttttgagacagaggagataataggctcttttctcacgagctccactccaaatagagtggcatcctgatgaaagaggaggatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0719 ABC-type transport system involved in Fe-S cluster assembly, permease component ... can be seen here [O] COG0396 ABC-type transport system involved in Fe-S cluster assembly, ATPase component ... can be seen here [O] COG0719 ABC-type transport system involved in Fe-S cluster assembly, permease component ... can be seen here [E] COG0520 Selenocysteine lyase ... can be seen here     ..................................................................................................................