                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:68 nt.    Distance to gene:95 nt.     Distance to run of Ts=1 nt.   Size=37 nt.     Delta G=-10.30 kcal/mol
Antiterminator:    Distance from promoter:53 nt. Size=33 nt.     Delta G= -4.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ctgaaa-ttggat. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ctgaaaaggaaatgattatacttttggatgatctttctaagcaagaagggctaatcgaagaaaggcggattgttcatataaaaatttttaaataaagaag
ctttttttaggagttcggtatcctgaaagggtttgtgtttttgagaaagagaaacttctttatagttctttatgctttgtgtgtaaaaggcttctatagg
aagagcaaatcagccgcttgcagagcaggagataagcATG

    psdD Gene: psdD     GI: 15605432     BI number: CT699     GOG: COG0688     Description: Phosphatidylserine Decarboxylas            cg           t  g   a       t  t a  g      g  a gc        at at        gc at        gc at        at t  t      t  | at        tg at        ta at        ta ta        ta tg        tg tg        tg ta        cg tg        gt at        at at        at             gtgtttttgagaaagagaaacttctttatagttctttatgctttgtgtgtaaaaggcttctataggaagagcaaatcagccgcttgcagagcaggagataagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG0688 Phosphatidylserine decarboxylase ... can be seen here     ..................................................................................................................