                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:119 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G= -9.00 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -9.80 kcal/mol
Anti-antiterminator:   Size=13 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCATagagagcaagatttaaggatgattacgaaaggcttcatcttccttgtttgcggattatctttgcaaagattttttaccttataagggaggggg
ggaactcttcatttgtgagcctctttgagaggagaacttcttctggactctctactgaaatcttgatatgatggagggtcgtttttatttttacccttga
atctaagagagttcccggtgttgtttcggagagaaggtttcttagatagtcgcttattagtgaacttcaaaatattaagcagtcgaaagacaagaggact
ggcATG

    yjbC Gene: yjbC     GI: 15605456     BI number: CT723     GOG: COG1187     Description: predicted pseudouridine synthas                       a                     g  t                     t  a            ga       t  t           a  a       cg            gc        ta            gt        at            at       a  |            gc       a  |            at       g  |            gt       t  |           t  c      c  |           t  t      a  |            tg        tg   t        cg        cg t  g       ta        ta t  a      c  c       cg cg       c  t       tg ta        gc        cg cg        at        at cg        gc        gc                         gtttttatttttacccttgaatctaagagagttcccggtgttgtttcggagagaaggtttcttagatagtcgcttattagtgaacttcaaaatattaagcagtcgaaagacaagaggactggcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG1187 16S rRNA uridine-516 pseudouridylate synthase and related pseudouridylate synthases ... can be seen here     ..................................................................................................................