                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:55 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-20.40 kcal/mol
Antiterminator: Size=72 nt.     Delta G=-11.70 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G= -9.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGGGAAAAAACACGAAATTCGTCTTTTTGCAGAGGCTGCAGGGTTACAGCTTCTGGA
ACTTAAAAGGATTCGCATAGGGAGCTTGGTATTAGGGGGCTTACCTTATGGAAAATAT
CGGGAGTTGACCGATTCTGAGTTAGATAGTTGCTTATCAGGGAAATCTGTGGCTCTCG
TCGCTTAGattagaaagagttttggtccttaagaacaaaaagagggaggtctttctccctctttttgttatttagaggtacactcaggaattag
gggcttgtagataacgaaactcgggagcggatATG

    CT724 --- birA Gene: CT724     GI: 15605457     BI number: CT724     GOG: NOG08100     Description: hypothetical protein Gene: birA     GI: 15605458     BI number: CT725     GOG: COG0340     Description: Biotin Synthetas            ga           a  g            at            at            gt            at            tg            tg            at            Gc           |  c           |  t            At AA        Ta G  A       Ta GT        Cg GC       |  a AT       |  a CG       G  c T  T      C  a A  |      T  a T  |      G  a TG       C  a CG        Ta GC        Cg        ct T  T       Ta       t  t T  |       Cg        gt GC       G  |       gc AT       G  |       at |  C      T  |       gc TG       G  |       gc AT        Tg        gc GC        Cg        at A  |       Ta        gc T  |      A  g       at TG       A  g       at GC        At        at AT        Gc        at GT        Gt        at TA        Gt        cg                         ttatttagaggtacactcaggaattaggggcttgtagataacgaaactcgggagcggatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0340 Biotin-(acetyl-CoA carboxylase) ligase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_trachomatis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:62 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -9.70 kcal/mol Antiterminator: Size=72 nt.     Delta G=-11.70 kcal/mol Anti-antiterminator:   Size=48 nt.     Delta G= -8.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AAGGGAAAAAACACGAAATTCGTCTTTTTGCAGAGGCTGCAGGGTTACAGCTTCTGGA ACTTAAAAGGATTCGCATAGGGAGCTTGGTATTAGGGGGCTTACCTTATGGAAAATAT CGGGAGTTGACCGATTCTGAGTTAGATAGTTGCTTATCAGGGAAATCTGTGGCTCTCG TCGCTTAGattagaaagagttttggtccttaagaacaaaaagagggaggtctttctccctctttttgttatttagaggtacactcaggaattag gggcttgtagataacgaaactcgggagcggatATG     CT724 --- birA Gene: CT724     GI: 15605457     BI number: CT724     GOG: NOG08100     Description: hypothetical protein Gene: birA     GI: 15605458     BI number: CT725     GOG: COG0340     Description: Biotin Synthetas            aa           a  a            ag            ca            ag            ag            gg            aa            ag            tg           |  t           |  c   T        tt C  T       ct G  A       c CG        t Ta       | Gt       | |  t      g |  a      g |  g      t |  a      t C  a      t Ta        t Cg        g Ta        a Cg        g Gt       a  | G  t      a  | T  t      a  | Gt       g  | Tg        a        ct Cg        t       t  t T  |       t        gt A  |      a         gc A  |      G         at At        A        gc Gc        T        gc Gc        T        gc Gt        C        at                         ctttttgttatttagaggtacactcaggaattaggggcttgtagataacgaaactcgggagcggatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0340 Biotin-(acetyl-CoA carboxylase) ligase ... can be seen here     ..................................................................................................................