                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:49 nt.     Distance to run of Ts=1 nt.   Size=39 nt.     Delta G=-26.50 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -6.27 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G=-10.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGGTCTGGAATATCTTTATCACAGAATTAAGCAAAGTTTTTTCTCAAGCAGCATCT
TTAGGGGCTTTCAGCGTTGCAGACGTTGCCGCGTTCGCGTCGACCTTAGGATTAGACT
CGGGGACCGTTACCTCAATTGTTGATGGGGAAAGGTGGGCTGAGCTGATCGATGTCGT
GATTCAGAACCCTGCTATATAAaggccattctaaaggccccctttccccggataggagaaagggggcttttgtattttccgctt
atttgcctccgaagcgggtgaaagcataagagtagtaggacaATG

    dagA_2 --- ybcL Gene: dagA_2     GI: 15605468     BI number: CT735     GOG: COG1115     Description: D-Ala/Gly Permease Gene: ybcL     GI: 15605469     BI number: CT736     GOG: COG1881     Description: hypothetical protei TG A  T GC CG        ct         a |  T      t  a      g  t |  G      t  a      g  a |  A      a  a       cg T  T       cg        cg AT        cg       c  a GC        gc        cg TA        gc        ta CG       a  c       ta G  A      A  c       ta A  A      A  c       cg G  C      T  t       cg T  |      A  t       cg C  |      T  t       cg GC       A  c       cg GC       T  c       gc G  T      C  c       gt T  G       Gc        at GC        Tg        at GT        Cg        at                         gtattttccgcttatttgcctccgaagcgggtgaaagcataagagtagtaggacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1115 Na+/alanine symporter ... can be seen here [R] COG1881 Phospholipid-binding protein ... can be seen here     ..................................................................................................................