                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:76 nt.     Distance to run of Ts=1 nt.   Size=28 nt.     Delta G= -7.00 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -3.80 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-12.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAACGGTAGAGCCGGTATAGCGCTCTAGCATGTCACAGGCGATTGTTTCTTCGCTG
ATTTTTTTATGCTGATGGGTCATaaatcacagatattataatggttagagaatctttttttctaaaaacatagtatgaagatg
gaacaagttgttctcgtgagggtaatagttgggctacttaaaagtatagttttcttttgcaagaaagagggaaagcgtttgtttcgcgacattcttctgg
acaaagcttagaagagaacgataacatagatggagaaaagataacgggttaagcgtgttATG

    efp_2 Gene: efp_2     GI: 15605485     BI number: CT752     GOG: COG0231     Description: Elongation Factor tg g  a cg tg        aa cg       t  a |  t       ta ta        cg ta        at gt       |  a ta       |  t tg        ta        ag g  |       cg       a  a at        gt       c  a at        gt       g  a cg        gt        tg a  g      t  t       ta a  g      t  |       tg gc        gc        tg gt        at        cg ta       t  t       ta a  |       at        ta gc        at        ta at        tg        tg at        gc        gc                         gtttgtttcgcgacattcttctggacaaagcttagaagagaacgataacatagatggagaaaagataacgggttaagcgtgttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0231 Translation elongation factor P (EF-P)/translation initiation factor 5A (eIF-5A) ... can be seen here     ..................................................................................................................