                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:169 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -7.70 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -4.70 kcal/mol
Anti-antiterminator:   Size=60 nt.     Delta G=-17.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCGTGATGCGGATTGCCAGATTGGGTTTTATAGCGCAGTGAGCGAGATTATGGATGC
CGTGAAAGCTCTCGTTCAACAGGGAGATGTTGTGTTGTTAAAAGGGTCTCGTAGTTTA
GAACTAGAGACTTTATTACCATGCTTTTCGATTTCATAGgtaaaagatcagaatttctttttagaatagaa
atagttaactttcaagtcgctgtaagatgctctttttaacttgccttttgaaagcttaagtttaagatagagaatttcttataggagcttcccataataa
aacgagaaaacagATG

    mraY --- murD --- nlpD --- ftsW --- murG --- murC/ddlA Gene: mraY     GI: 15605490     BI number: CT757     GOG: COG0472     Description: Muramoyl-Pentapeptide Transferase Gene: murD     GI: 15605491     BI number: CT758     GOG: COG0771     Description: UDP-N-acetylmuramoylalanine-D-glutamate ligase Gene: nlpD     GI: 15605492     BI number: CT759     GOG: COG1388     Description: Muramidase (invasin repeat family) Gene: ftsW     GI: 15605493     BI number: CT760     GOG: COG0772     Description: Cell Division Protein FtsW Gene: murG     GI: 15605494     BI number: CT761     GOG: COG0707     Description: Peptidoglycan Transferase Gene: murC/ddlA     GI: 15605495     BI number: CT762     GOG: COG0773,COG1181     Description: UDP-N-acetylmuramate-alanine ligase and D-Ala-D-Ala Ligas   T A  G GC GC TG AT TG TA |  A |  A |  G |  C AT GC AT GC CG GT AT         G GC       T  T TA       T  T |  A      G  A |  C      T  A |  A      G  A |  G       TA |  G       TG         A |  G      G  G      T  G |  A       TG        TA |  G       AT        TA |  A       GC        GC |  T       AT        AT |  G       GC        TA GT       G  G      G  | AT       G  T       CG CG       A  A       TA GT        CG        CG CG        AT        TA GT        AT        GC                         TTTATTACCATGCTTTTCGATTTCATAGgtaaaagatcagaatttctttttagaatagaaatagttaactttcaagtcgctgtaagatgctctttttaacttgccttttgaaagcttaagtttaagatagagaatttcttataggagcttcccataataaaacgagaaaacagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0472 UDP-N-acetylmuramyl pentapeptide phosphotransferase/UDP-N-acetylglucosamine-1-phosphate transferase ... can be seen here [M] COG0771 UDP-N-acetylmuramoylalanine-D-glutamate ligase ... can be seen here [M] COG1388 FOG: LysM repeat ... can be seen here [D] COG0772 Bacterial cell division membrane protein ... can be seen here [M] COG0707 UDP-N-acetylglucosamine:LPS N-acetylglucosamine transferase ... can be seen here [M] COG0773 UDP-N-acetylmuramate-alanine ligase ... can be seen here [M] COG1181 D-alanine-D-alanine ligase and related ATP-grasp enzymes ... can be seen here     ..................................................................................................................