                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:59 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -9.20 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -7.26 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttttatgttcatgatgagaacgatcgcaaaatgttgcgagaaaagccttagctctttgaaataaaaatatgtccataaggatagcagagaagtcctaat
cttgctctggcatggaagttagcttgagtacggtgactaggtttttgagaaagctcttcaaagagtaggggatctcgctagaggaaagaggctatttttg
gtaaagaatatccacgagagctagggctcaaagggatttttctctttagaaaaaaagctcgaccttatcttagataatcgggtattctcaggccagtttc
ATG

    ybeB --- fabF --- CT771 Gene: ybeB     GI: 15605502     BI number: CT769     GOG: COG0799     Description: iojap superfamily ortholog Gene: fabF     GI: 15605503     BI number: CT770     GOG: COG0304     Description: Acyl Carrier Protein Synthase Gene: CT771     GI: 15605504     BI number: CT771     GOG: COG0494     Description: hydrolase/phosphatase homolo gt g  a ta ta tg ta ta at ta c  t gc        ag gc       t  g a  a       cg g  c       gc a  g       at a  a       gc a  g      a  a g  a      g  a g  g      c  a a  |      a  g gc        cg at        cg ta        ta cg        at             ttttctctttagaaaaaaagctcgaccttatcttagataatcgggtattctcaggccagtttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0799 Uncharacterized homolog of plant Iojap protein ... can be seen here [IQ] COG0304 3-oxoacyl-(acyl-carrier-protein) synthase ... can be seen here [LR] COG0494 NTP pyrophosphohydrolases including oxidative damage repair enzymes ... can be seen here     ..................................................................................................................