                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:136 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-14.90 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -7.60 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-14.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGGGATTTGAGCCTGGAGGCGGAGAGGCATATGTTTATAGATTAAAGAAAGCATTAC
ATATCTCCTGAgtacgcgcgtaattctcttttttaataagagaaaaacgtgttcccattctcggatttccaagaaagagaaaacgacccagt
tttctctttctattttggagaaagcaagctgcatatcctctctcttcaaaatttctcaagtttgatgtagcatgatgagtctgcttaagactttagtgat
tgtcgtaagaagaaaaatattgctactatttttgagccaaaggacggttgATG

    lysS Gene: lysS     GI: 15605514     BI number: CT781     GOG: COG1190     Description: Lysyl tRNA Synthetas   t t  a t  a t  t ta ta cg ta cg ta ta a  a       tt a  a      a  t ta        gc gc        gc cg       c  a       cc gt        ta       a  c cg        cg       g  a gt        ta        cg |  t       ta        at |  c      a  a       at |  c      c  g       at |  c      c  a       at c  a       cg        gc a  t       ta        at t  t       ta        gc gc       g  a       at At        ta        at Gc        gc        at Tg        cg        gc                         tattttggagaaagcaagctgcatatcctctctcttcaaaatttctcaagtttgatgtagcatgatgagtctgcttaagactttagtgattgtcgtaagaagaaaaatattgctactatttttgagccaaaggacggttgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG1190 Lysyl-tRNA synthetase (class II) ... can be seen here     ..................................................................................................................